
Chinese Journal of Applied Chemistry ›› 2024, Vol. 41 ›› Issue (1): 109-117.DOI: 10.19894/j.issn.1000-0518.220401
• Full Papers • Previous Articles Next Articles
Yang SHU, Man YANG, Zhi-Hao LI, Jian-Hua WANG()
Received:
2022-12-12
Accepted:
2023-03-18
Published:
2024-01-01
Online:
2024-01-30
Contact:
Jian-Hua WANG
About author:
jianhuajrz@mail.neu.edu.cnSupported by:
CLC Number:
Yang SHU, Man YANG, Zhi-Hao LI, Jian-Hua WANG. MicroRNA Sensing Based on Gold Nanoparticle Aggregation and Hybridization Chain Amplification[J]. Chinese Journal of Applied Chemistry, 2024, 41(1): 109-117.
Oligonucleotide | Sequence (5'-3') |
---|---|
H1 | TATGGCTGGGAGTGTCGCATGCTAGCGACACTCCCA |
H2 | GCGACACTCCCAGCCATATGGGAGTGTCGCTAGCAT |
HP21 | GCGACACTCCCAGCCATATCAACATCAGTCTGATAAGCTATATGGCTGGG |
HP31 | GCGACACTCCCAGCCATATCAACATCAGTCTGATAAGCTATATGGCTGGG |
miRNA-21 | UAGCUUAUCAGACUGAUGUUGA |
miRNA-31 | AGGCAAGATGCTGGCATAGCT |
miRNA-let-7a | TGAGGTAGTAGGTTGTATAGTT |
miRNA-10b | TACCCTGTAGAACCGAATTTGTG |
miRNA-155 | TTAATGCTAATCGTGATAGGGGT |
Table 1 The sequences of oligonucleotides adopted in the present study
Oligonucleotide | Sequence (5'-3') |
---|---|
H1 | TATGGCTGGGAGTGTCGCATGCTAGCGACACTCCCA |
H2 | GCGACACTCCCAGCCATATGGGAGTGTCGCTAGCAT |
HP21 | GCGACACTCCCAGCCATATCAACATCAGTCTGATAAGCTATATGGCTGGG |
HP31 | GCGACACTCCCAGCCATATCAACATCAGTCTGATAAGCTATATGGCTGGG |
miRNA-21 | UAGCUUAUCAGACUGAUGUUGA |
miRNA-31 | AGGCAAGATGCTGGCATAGCT |
miRNA-let-7a | TGAGGTAGTAGGTTGTATAGTT |
miRNA-10b | TACCCTGTAGAACCGAATTTGTG |
miRNA-155 | TTAATGCTAATCGTGATAGGGGT |
Fig.1 Schematic illustration for high sensitive colorimetric detection of miRNA based on the aggregation of gold nanoparticles (AuNPs) and hybridization chain reaction (HCR) amplification
Fig.2 (A) UV-Vis absorption spectra for the colorimetric detection system in the absence and presence of 5 nmol/L target miRNA-21. Inset illustrated the photographs of AuNPs solution. (B) Polyacrylamide gel electrophoresis images. From left to right, lane 1: DNA marker; lane 2: 1 μmol/L H1+1 μmol/L H2; lane 3: 1 μmol/L H1+1 μmol/L H2+50 nmol/L Target miRNA-21; lane 4: 1 μmol/L H1+1 μmol/L H2+100 nmol/L HP21; lane 5: 1 μmol/L H1+1 μmol/L H2+100 nmol/L HP21+50 nmol/L Target miRNA-21. (C) TEM images of AuNPs in the absence of target miRNA-21 (The inset represents the TEM size distribution of AuNPs). (D) TEM images of AuNPs in the presence of 5 nmol/L target miRNA-21
Fig 3 (A) The effect of HCR reaction time on the sensing performance. (B) The effect of H1/H2 concentration on the aggregation of AuNPs and the sensing performance. (C) The effect of NaCl concentration on the aggregation of AuNPs and the performance of colorimetric reaction. (D) The effect of AuNPs concentration on the response of the sensing system. Red columns: control experiments; green columns: with 5.0 nmol/L of target miRNA. (E) The effect of temperature on HCR reaction efficiency. Lane 1: DNA marker; Lane 2: 1 μmol/L H1+1 μmol/L H2; Lane 3 1 μmol/L H1+1 μmol/L H2+50 nmol/L target miRNA-21; Lane 4: 1 μmol/L H1+1 μmol/L H2+100 nmol/L HP21; Lanes 5-9: 1 μmol/L H1+1 μmol/L H2+100 nmol/L HP21+50 nmol/L target miRNA-21 at 4, 20, 25, 37 and 44 ℃, respectively. (F) Histogram of the intensity of the residual H1/H2 bands in lanes 5-9 as indicated in Fig.3E. (G) The effect of buffer pH value on HCR reaction efficiency. Lane 1: DNA marker; Lane 2: 1 μmol/L H1+1 μmol/L H2; Lane 3: 1 μmol/L H1+1 μmol/L H2+50 nmol/L target miRNA-21; Lane 4: 1 μmol/L H1+1 μmol/L H2+100 nmol/L HP21; Lanes 5-9: 1 μmol/L H1+1 μmol/L H2+100 nmol/L HP21+50 nmol/L target miRNA-21, corresponding to pH vales of 6.0, 6.5, 7.0, 7.5 and 8.0, respectively. (H) Histogram of the intensity of the residual H1/H2 bands as indicated in lanes 5-9 in Fig.3G. The error bars represent the standard deviation of triplicate detections
Fig.4 (A) The photographs of colorimetric response of the detection system in the presence of different concentrations of target miRNA-21. From left to right the concentrations of target miRNA-21were 0, 0.05, 0.1, 0.2, 0.3, 0.5, 1.0, 2.0, 4.0 and 6.0 nmol/L. (B) UV-visible absorption spectra of the sensing system in the presence of various concentrations of miRNA-21. (C) The relationship between target miRNA-21 concentration and absorbance A523 (The inset represents the linear calibration within a concentration range of 0.05~0.5 nmol/L). (D) The specific detection of target miRNA-21 by sensing system. The concentration of miRNA was 5.0 nmol/L. (E) Anti-interference test for the detection of miRNA-21 in the presence of BSA, Lys, Glu and Cys contained in serum. The concentrations of BSA, Lys, Glu and Cys were 1 μmol/L, 1 mmol/L, 1 μg/mL and 5 g/L, respectively. The error bars represent the standard deviation of three repetitive detections
Target | Detection method | Linear range/(nmol·L-1) | Detection limit/(pmol·L-1) | Ref. |
---|---|---|---|---|
miRNA-21 | Colorimetric method | 0~10 | 2 600 | [ |
miRNA-155 | Colorimetric method | 1~100 | 700 | [ |
miRNA-146a | Colorimetric method | 0.38~40 | 1 300 | [ |
miRNA-34c | Colorimetric method | 0~0.1 | 5 | [ |
miRNA-let-7a | Colorimetric method | 0~400 | 63.2 | [ |
miRNA-21 | Colorimetric method | 0.05~0.5 | 15 | This work |
Table 2 Comparison of different miRNA detection methods
Target | Detection method | Linear range/(nmol·L-1) | Detection limit/(pmol·L-1) | Ref. |
---|---|---|---|---|
miRNA-21 | Colorimetric method | 0~10 | 2 600 | [ |
miRNA-155 | Colorimetric method | 1~100 | 700 | [ |
miRNA-146a | Colorimetric method | 0.38~40 | 1 300 | [ |
miRNA-34c | Colorimetric method | 0~0.1 | 5 | [ |
miRNA-let-7a | Colorimetric method | 0~400 | 63.2 | [ |
miRNA-21 | Colorimetric method | 0.05~0.5 | 15 | This work |
Fig.5 (A) The relationship between target miRNA-31 concentration and absorbance A523 (The inset represents the linear calibration within a concentration range of 0.05~0.50 nmol/L). (B) The specific detection of target miRNA-31 by the sensing system. The concentration of miRNA was 5.0 nmol/L
Target | Sample | Added/(pmol·L-1) | Found/(pmol·L-1) | Recovery/% | RSD/% |
---|---|---|---|---|---|
miRNA-21 | 1 | 50 | 55.8 | 112 | 2.3 |
2 | 100 | 104.7 | 105 | 1.7 | |
3 | 150 | 146.3 | 98 | 1.2 | |
miRNA-31 | 1 | 50 | 45.5 | 91 | 1.8 |
2 | 100 | 101.0 | 101 | 2.7 | |
3 | 150 | 166.7 | 111 | 2.1 |
Table 3 The spiking recovery of miRNA-21 and miRNA-31 in diluted human serum samples (n=3)
Target | Sample | Added/(pmol·L-1) | Found/(pmol·L-1) | Recovery/% | RSD/% |
---|---|---|---|---|---|
miRNA-21 | 1 | 50 | 55.8 | 112 | 2.3 |
2 | 100 | 104.7 | 105 | 1.7 | |
3 | 150 | 146.3 | 98 | 1.2 | |
miRNA-31 | 1 | 50 | 45.5 | 91 | 1.8 |
2 | 100 | 101.0 | 101 | 2.7 | |
3 | 150 | 166.7 | 111 | 2.1 |
1 | MALUMBRES M. MiRNAs and cancer: an epigenetics view[J]. Mol Aspects Med, 2013, 34(4): 863-874. |
2 | KORNFELD S F, CUMMINGS S E, FATHI S, et al. MiRNA-145-5p prevents differentiation of oligodendrocyte progenitor cells by regulating expression of myelin gene regulatory factor[J]. J Cell Physiol, 2020, 236(2): 997-1012. |
3 | ROTIVAL M, SIDDLE K J, SILVERT M, et al. Population variation in miRNAs and isomirs and their impact on human immunity to infection[J]. Genome Biol, 2020, 21(1): 187. |
4 | ZHOU Z, FAN D, WANG J, et al. Triggered dimerization and trimerization of DNA tetrahedra for multiplexed miRNA detection and imaging of cancer cells[J]. Small, 2021, 17(6): 200735. |
5 | LEMPRIERE S. Exosomal microRNA is promising biomarker in PD[J]. Nat Rev Neurol, 2022, 18(2): 65. |
6 | WU Y, CUI S, LI Q, et al. Recent advances in duplex-specific nuclease-based signal amplification strategies for microRNA detection[J]. Biosens Bioelectron, 2020, 165: 112449. |
7 | BING Z T. Triple signal amplification strategy for ultrasensitive determination of miRNA based on duplex specific nuclease and bridge DNA-gold nanoparticles[J]. Anal Chem, 2018, 90(3): 2395-2400. |
8 | QIANG L A, MEI L B, YAN J A, et al. Rapid and enzyme-free signal amplification for fluorescent detection of microRNA via localized catalytic hairpin assembly on gold nanoparticles[J]. Talanta, 2021, 242: 123142. |
9 | ZHU Y, WANG J, XIE H. NIR-to-vis handheld platforms for detecting miRNA level and mutation based on sub-10 nm sulfide nanodots and HCR amplification[J]. ACS Appl Mater Interfaces, 2022, 14(8): 10212-10226. |
10 | BAI M, CHEN F, CAO X, et al. Intracellular entropy-driven multi-bit DNA computing for tumor progression discrimination[J]. Angew Chem Int Ed, 2020, 59(32): 13267-13272. |
11 | YANG Y, YANG J, GONG F, et al. Combining CRISPR/Cas12a with isothermal exponential amplification as an ultrasensitive sensing platform for microRNA detection[J]. Sens Actuators B: Chem, 2022, 367: 132158. |
12 | HUANG J, SHANG G J F, GUO Q P, et al. Colorimetric and fluorescent dual-mode detection of microRNA based on duplex-specific nuclease assisted gold nanoparticle amplification[J]. Analyst, 2019, 144(16): 4917-4924. |
13 | DIRKS R M, PIERCE N A. Triggered amplification by hybridization chain reaction[J]. PANS, 2004, 101(43): 15275-15278. |
14 | SAISUK W, SUKSAMAI C, SRISAWAT C, et al. The helper oligonucleotides enable detection of folded single-stranded DNA by lateral flow immunoassay after HCR signal amplification[J]. Talanta, 2022(248): 123588. |
15 | ZHAO K, PENG Z, JIANG H, et al. Shape-coded hydrogel microparticles integrated with hybridization chain reaction and a microfluidic chip for sensitive detection of multi-target miRNAs[J]. Sens Actuators B: Chem, 2022, 361: 131741. |
16 | DANIEL M C, ASTRUC D. Gold nanoparticles: assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology[J]. Chem Rev, 2004, 104(1): 293-346. |
17 | ZHEN M Z, XIN M, MIAO P. Roll-to-roll DNA nanomachine for ultrasensitive electrochemical determination of miRNA[J]. Langmuir, 2022, 38(36): 11130-11135. |
18 | GRABAR K C, FREEMAN R G, HOMMER M B, et al. Preparation and characterization of Au colloid monolayers[J]. Anal Chem, 1995, 67(4): 735-743. |
19 | CAO J, LV P, SHU Y, et al. Aptamer/AuNPs encoders endow precise identification and discrimination of lipoprotein subclasses[J]. Biosens Bioelectron, 2021, 196: 113743. |
20 | BOMI S, JISEON P, HANGSUK C, et al. A fluorescence/colorimetric dual-mode sensing strategy for miRNA based on graphene oxide[J]. Anal Bioanal Chem, 2020, 412(1): 233-242. |
21 | KOSAR S, EHSAN S, MORTEZA H. Sensitive colorimetric detection of miRNA-155 via G-quadruplex DNAzyme decorated spherical nucleic acid[J]. Mikrochim Acta, 2022, 189: 357. |
22 | SANCHEZ V A, LOSADA M J, SOLDADO C A, et al. A portable device for miRNAs detection based on a gold-nanoparticle ratiometric colorimetric strategy[J]. IEEE Trans Instrum Meas, 2022, 71: 7006009. |
23 | MOTOI O, SATOMI S. An efficient particle‐based DNA circuit system: catalytic disassembly of DNA/PEG-modified gold nanoparticle-magnetic bead composites for colorimetric detection of miRNA[J]. Small, 2016, 12(37): 5153-5158. |
24 | HUO X, FENG L Y, DAN L C, et al. Trigging stepwise-strand displacement amplification lights up numerous G-quadruplex for colorimetric signaling of serum microRNAs[J]. iScience, 2023, 26(4): 106331. |
25 | 杨培, 张龙飞, 田宇,等. 生物样品测定分析方法中提取回收率的探讨[J]. 中华中医药杂志, 2015, 30(3): 722-726. |
YANG P, ZHANG L F, TIAN Y, er al. Discussion of recovery in biological sample determination methodology[J]. China J Tradit Chin Med Pharm, 2015, 30(3): 722-726. |
[1] | Yi XU, Meng-Yao LIN, Xiao-Qun GONG. Research Progress of Multicolor Colorimetric Method in Biosensing Platform [J]. Chinese Journal of Applied Chemistry, 2024, 41(1): 3-20. |
[2] | Da-Wei TONG, Ming KONG, Yu-Bin XIANG. Synthesis, Photophysical Properties, Theoretical Calculation and Cell Imaging of a Tetraphenylethene Imidazole Compound with Methoxy Group [J]. Chinese Journal of Applied Chemistry, 2023, 40(9): 1322-1329. |
[3] | Yue YANG, Shi-Wen HUANG, Yue TONG, Ze-Da CHEN, Ben-Hua MA, Chuan-Dong DOU. Donor-Acceptor Type Chiral Tetracoordinate Organoboranes and Their Optical Properties [J]. Chinese Journal of Applied Chemistry, 2023, 40(5): 743-748. |
[4] | Feng-Zhou XU, Hua-Ying TANG, Wu-Hui LIU, Yi-Feng JIANG, Wen-Kai LI, Xian-Hai LU. A Visual Semi⁃quantitative Method for Rapid Detection of Copper Ion in Water [J]. Chinese Journal of Applied Chemistry, 2022, 39(8): 1303-1311. |
[5] | ZHANG Yanping, XUE Dongfeng. Influence of Sodium and Potassium Ions on Dihydrogen Phosphate Anion Raman Spectra [J]. Chinese Journal of Applied Chemistry, 2020, 37(7): 823-829. |
[6] | LI Xinyi,WANG Xiaohua,ZHOU Xiaodong,HU Jiming. Research Progress on Biosensing Based on Peptides and Gold Nanoparticles Composite Materials [J]. Chinese Journal of Applied Chemistry, 2019, 36(5): 489-499. |
[7] | CHENG Jinhua, JIANG Hongji. Study on Self-assembly Behaviors of an Amphiphilic Block Polymer by Terminally Grafting Tetraphenylethene-Based Aggregation-Induced Emission Active Moietys [J]. Chinese Journal of Applied Chemistry, 2019, 36(4): 440-450. |
[8] | DANG Lifang,WANG Ruixin,XIE Meina,JIAO Weizhou. Research Progress of Polyoxometalates and Their Self-aggregation Behaviors in Solution [J]. Chinese Journal of Applied Chemistry, 2018, 35(6): 625-644. |
[9] | Lingling LI, Shaoming YANG, Shaoqing DING, Peiling SHANG, Jie YANG, Qiang CAO, Wenling ZHA. Preparation and Application of Bisphenol-A TiO2 Gel Molecularly Imprinted Electrochemical Sensor Based on the Sensitivity-Enhancement of Gold Nanoparticles [J]. Chinese Journal of Applied Chemistry, 2018, 35(4): 484-490. |
[10] | YU Chang,SHAO Shuai,LI Hejie,LIU Guofeng,DING Binbin,MA Ping'an,LIN Jun. Upconversion Nanoparticles Decorated with Hybridization Chain Reaction DNA for Near-infrared Light Controlled Release Doxorubicin [J]. Chinese Journal of Applied Chemistry, 2018, 35(12): 1485-1491. |
[11] | YU Chang, SHAO Shuai, LI Hejie, LIU Guofeng, DING Binbin, MA Ping'an, LIN Jun. Upconversion Nanoparticles Decorated with Hybridization Chain Reaction DNA for Near-infrared Light Controlled Release Doxorubicin [J]. Chinese Journal of Applied Chemistry, 2018, 35(12): 0-0. |
[12] | MA Li,XU Jingwei,YANG Chuanqi,LI Yunhui,MA Yuqin,ZHAO Yongxia. Effect of Polyhedral Oligomeric Silsesquioxanes-modified Gold Nanoparticles on 4-n-Pentyl-4'-ctanobiphenyl Liquid Crystal Properties [J]. Chinese Journal of Applied Chemistry, 2018, 35(11): 1378-1383. |
[13] | WANG Tao,MA Lamaocao,MA Hengchang. Research Progress on Cell Imaging Based on the Aggregation-induced Emission Fluorescent Probes [J]. Chinese Journal of Applied Chemistry, 2018, 35(10): 1155-1165. |
[14] | LI Yueqing,WU Qianqian,SONG Qilin,CAO Lei,QIN Qiuyan,XU Yan,ZHAO Weijie. Synthesis and Anti-platelet Aggregation Assay of Cinnamoyl-tyramine Amide Analogues [J]. Chinese Journal of Applied Chemistry, 2018, 35(10): 1174-1183. |
[15] | LI Yueqing, WU Qianqian, SONG Qilin, CAO Lei, QIN Qiuyan, XU Yan, ZHAO Weijie. Synthesis and Anti-platelet Aggregation Assay of Cinnamoyl-tyramine Amide Analogues [J]. Chinese Journal of Applied Chemistry, 2018, 35(10): 0-0. |
Viewed | ||||||||||||||||||||||||||||||||||||||||||||||||||
Full text 295
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Abstract 322
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||