Self‑Assembled MicroRNA‑21 Responsive Zn2+/DNA Nanoparticles for Tumor Fluorescence Imaging and Oxidative Stress Therapy

doi:10.19894/j.issn.1000-0518.230263

Chinese Journal of Applied Chemistry ›› 2024, Vol. 41 ›› Issue (1): 164-174.DOI: 10.19894/j.issn.1000-0518.230263

• Full Papers • Previous Articles

Self‑Assembled MicroRNA‑21 Responsive Zn²⁺/DNA Nanoparticles for Tumor Fluorescence Imaging and Oxidative Stress Therapy

Xin XU, Ye LI, Min WANG, Zhang-Cheng FU, Guo-Min QI(), Chun-Hua LU()

College of Chemistry，Fuzhou University，Fuzhou 350116，China

Received:2023-08-30 Accepted:2023-11-18 Published:2024-01-01 Online:2024-01-30
Contact: Guo-Min QI,Chun-Hua LU
About author:chunhualu@fzu.edu.cn
961043190@qq.com
Supported by:
the National Key R&D Program of China(2018YFA0902600);the National Natural Science Foundation of China(22174019);the Natural Science Foundation of Fujian(2020J06036)

Abstract

Abstract:

The specificity， programmability and biocompatibility of DNA materials make them advantageous for applications in bio-detection and drug delivery. To further expand the applications and synthesis methods of DNA materials， in this study， Zn²⁺/DNA self-assembled nanoparticles （ZDNPs） with tumor-responsive marker microRNA-21 (miR-21) are simply and efficiently synthesized by utilizing the cooperative interaction between DNA and metal ions. Through the specific complementarity of the DNA hairpin structure in ZDNPs with miR-21， the fluorescent signal is activated and Zn²⁺ is released， which result in intracellular ROS production and can be used for fluorescence imaging and oxidative stress therapy of tumor. The synthesized ZDNPs are uniformly shaped spherical particles that can effectively load Zn²⁺. Depending on the responsive experiment of ZDNPs to miR-21， it is verified that there is a good linear fluorescence response signal with specificity between ZDNPs and miR-21 concentration. The linear response range is 5~160 nmol/L， and the detection limit is 5 nmol/L. The intracellular effects of ZDNPs are also investigated， and the results show that they can perform responsive fluorescence imaging， and mediate apoptosis of tumor cells through the oxidative stress pathway. As for in vivo fluorescence imaging and tumor therapy， ZDNPs demonstrate specific and sustained tracing ability at tumor lesion sites and produce significant growth inhibition effects on tumor.

Key words: DNA hairpin, Zinc ion, microRNA-21, Tumor imaging, Oxidative stress therapy

CLC Number:

O654.9

Xin XU, Ye LI, Min WANG, Zhang-Cheng FU, Guo-Min QI, Chun-Hua LU. Self‑Assembled MicroRNA‑21 Responsive Zn²⁺/DNA Nanoparticles for Tumor Fluorescence Imaging and Oxidative Stress Therapy[J]. Chinese Journal of Applied Chemistry, 2024, 41(1): 164-174.

Figures/Tables 14

Fig.1 Schematic illustration of ZDNPs synthesis process and miR-21 responsive fluorescence imaging and oxidative stress therapy of ZDNPs in tumor

Table 1 DNA sequences in this study

No.	Name	Sequences
1	Hairpin	5′?TCAGCATCAGTCTGATAAGCAACATTGGATGCTGA?3′
2	Hairpin?FL	5′?Cy5?TCAGCATCAGTCTGATAAGCAACATTGGATGCTGA?BHQ2?3′
3	Random DNA	5′?TCAGCATCGTGAATCTACGAAACATTGGATGCTGA?3′
4	miR?21	5′?TAGCTTATCAGACTGATGTTGA?3′
5	let?7a	5′?TGAGGTAGTAGGTTGTATAGTT?3′
6	miRNA?429 （miR-429）	5′?GTCTTACCAGACAAAGTTAGA?3′
7	miRNA?144 （miR-144）	5′?GGATATCATCATATACTGTAAG?3′
8	miRNA?155 （miR-155）	5′?TTAATGCTAATCGTGATAGGGGTT?3′

Fig.2 Responsiveness of DNA hairpin to different concentrations of miR-21 （A）； Linear relationship between different concentrations of miR-21 and fluorescence intensity （B）

Fig.3 TEM image and particle size distribution of ZDNPs （A） and particle size changes of ZDNPs in PBS （B）

Fig.4 Responsiveness of ZDNPs to different concentrations of miR-21 （A）； Linear relationship between different concentrations of miR-21 and fluorescence intensity （B）

Fig.5 Selectivity of ZDNPs to miR-21

Fig.6 MiR-21 response imaging of ZDNPs in L02 and MCF-7

Fig.7 Cytotoxicity assay of ZDNPs to L02 and MCF-7

Fig.8 Confocal fluorescence images of ROS production by ZDNPs in MCF-7 cells. Scale bar indicates 100 μm

Fig.9 Fluorescence imaging of ZDNPs and Random at different time in tumor-bearing mice.Scale bar indicates 15 mm

Fig.10 Tumor growth curves of mice in different treatment groups

Fig.11 Tumor photos of mice in different treatment groups at day 14

Fig.12 Body weight curves of mice in different treatment groups

Fig.13 Major organs and tumor sections of mice in different treatment groups at day 14. Scale bar indicates 200 μm

References 20

1	OUYANG T， LIU Z， HAN Z， et al. MicroRNA detection specificity： recent advances and future perspective［J］. Anal Chem， 2019， 91（5）： 3179-3186.
2	CHENG Y， DONG L， ZHANG J， et al. Recent advances in microRNA detection［J］. Analyst， 2018， 143（8）： 1758-1774.
3	DENG W， ZHANG X， MA Z， et al. MicroRNA-125b-5p mediates post-transcriptional regulation of hepatitis B virus replication via the LIN28B/let-7 axis［J］. RNA Biol， 2017， 14（10）： 1389-1398.
4	ABDULLAH AL-MASKRI A A， YE J， TALAP J， et al. Reverse transcription-based loop-mediated isothermal amplification strategy for real-time miRNA detection with phosphorothioated probes［J］. Anal Chim Acta， 2020， 1126： 1-6.
5	LIU J， CAO Z， LU Y. Functional nucleic acid sensors［J］. Chem Rev， 2009， 109（5）： 1948-1998.
6	LI Y， DENG J， HAN Z， et al. Molecular identification of tumor-derived extracellular vesicles using thermophoresis-mediated DNA computation［J］. J Am Chem Soc， 2021， 143（3）： 1290-1295.
7	AUGSPURGER E E， RANA M， YIGIT M V. Chemical and biological sensing using hybridization chain reaction［J］. ACS Sens， 2018， 3（5）： 878-902.
8	LIU J， ZHANG Y， XIE H， et al. Applications of catalytic hairpin assembly reaction in biosensing［J］. Small， 2019， 15（42）： e1902989.
9	WANG J， SUN Y， LAU C， et al. Target-fueled catalytic hairpin assembly for sensitive and multiplex microRNA detection［J］. Anal Bioanal Chem， 2020， 412（13）： 3019-3027.
10	WANG D X， WANG J， WANG Y X， et al. DNA nanostructure-based nucleic acid probes： construction and biological applications［J］. Chem Sci， 2021， 12（22）： 7602-7622.
11	WALIA S， CHANDRASEKARAN A R， CHAKRABORTY B， et al. Aptamer-programmed DNA nanodevices for advanced， targeted cancer theranostics［J］. ACS Appl Bio Mater， 2021， 4（7）： 5392-5404.
12	YU W， XUAN C， LIU B， et al. Carrier-free programmed spherical nucleic acid for effective ischemic stroke therapy via self-delivery antisense oligonucleotide［J］. Nano Res， 2022， 16（1）： 735-745.
13	LI J， ZHENG C， CANSIZ S， et al. Self-assembly of DNA nanohydrogels with controllable size and stimuli-responsive property for targeted gene regulation therapy［J］. J Am Chem Soc， 2015， 137（4）： 1412-1415.
14	LI X， YANG Y， ZHAO H， et al. Enhanced in vivo blood-brain barrier penetration by circular Tau-transferrin receptor bifunctional aptamer for tauopathy therapy［J］. J Am Chem Soc， 2020， 142（8）： 3862-3872.
15	NGOEPE M P， CLAYTON H S. Metal complexes as DNA synthesis and/or repair inhibitors： anticancer and antimicrobial agents［J］. Pharm Fronts， 2021， 3（4）： e164-e182.
16	LI M， WANG C， DI Z， et al. Engineering multifunctional DNA hybrid nanospheres through coordination-driven self-assembly［J］. Angew Chem Int Ed， 2019， 58（5）： 1350-1354.
17	ZHOU J， HAN H， LIU J. Nucleobase， nucleoside， nucleotide， and oligonucleotide coordinated metal ions for sensing and biomedicine applications［J］. Nano Res， 2021， 15（1）： 71-84.
18	WANG J， WANG H， WANG H， et al. Nonviolent self-catabolic DNAzyme nanosponges for smart anticancer drug delivery［J］. ACS Nano， 2019， 13（5）： 5852-5863.
19	BISHOP G M， DRINGEN R， ROBINSON S R. Zinc stimulates the production of toxic reactive oxygen species （ROS） and inhibits glutathione reductase in astrocytes［J］. Free Radical Bio Med， 2007， 42（8）： 1222-1230.
20	HUBNER C， HAASE H. Interactions of zinc- and redox-signaling pathways［J］. Redox Biol， 2021， 41： 101916.

[1]	SU Ce, CHANG Kaishan, LI Siliang, LI Guanbin, ZHANG Hongbo, BAI Lingling. Synthesis and Properties of a Zn²⁺ Fluorescent Probe Based on Coumarins [J]. Chinese Journal of Applied Chemistry, 2018, 35(5): 532-537.
[2]	BU Lulu,WANG Qing,XIE Yongshu. Research Progress of Fluorescent Zinc Probes [J]. Chinese Journal of Applied Chemistry, 2017, 34(12): 1355-1369.
[3]	Wu Zhiyuan, Du Mifang, Yang Hanxi, Li Shenxian, Fan Yuzhang. ELECTROCHEMICAL INTERCALATION OF ZINC INTO SPINEL MANGANESE DIOXIDE [J]. Chinese Journal of Applied Chemistry, 1992, 0(2): 99-101.

Self‑Assembled MicroRNA‑21 Responsive Zn²⁺/DNA Nanoparticles for Tumor Fluorescence Imaging and Oxidative Stress Therapy

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 14

References 20

Related Articles 3

Recommended Articles

Metrics

Comments